Avena sativa Markers

Chromosome 3C @ 625064144



Genotype locations  
Marker Protocol Species Reference Chromosome Position Ref Alt
avgbs2_64985.1.24 GBS POGI v2 Avena sativa OT3098 v2 3C 625064144 T C
avgbs2_64985.1.24 Tinker QTL 2021 Avena sativa OT3098 v2 3C 625064144 T C
avgbs_cluster_12994.1.24 Tinker QTL 2021 Avena sativa OT3098 v2 3C 625064144 T C
avgbs_cluster_12994.1.24 GBS POGI v2 Avena sativa OT3098 v2 3C 625064144 T C
Flanking Sequence  

avgbs2_64985.1.24, avgbs2_64985.1.24, avgbs_cluster_12994.1.24, avgbs_cluster_12994.1.24

TGCAGCCAAGCRCCCTCTCTACT[T/C]TGATCCTGATTTCAATCTCCAATTCCGCACAATACAAAAT
Related Markers  

Related Genotyped Markers: These genotyped markers share either the same name as one or more markers at this variant or are located at the same position but have different allele values

Related Mapped Markers: These mapped markers have the same name as a marker at this variant
External Links  
Genome Browser  
Genome Browser - JBrowse
Sequence Metadata  

Reference Genome Species Feature Start End
OT3098 v2 Avena sativa 3C 625064144 625064144 Modify Query



Powered By


Version
3440b150d   sgn-309.0
Wed Nov 17 19:07:33 2021 +0000

Partners



Funded By

T3 is part of the Wheat CAP project, supported by Agriculture and Food Research Initiative Competitive Grant no. 2011-68002-30029 from the USDA National Institute of Food and Agriculture.